View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1781_low_11 (Length: 251)
Name: NF1781_low_11
Description: NF1781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1781_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 29 - 214
Target Start/End: Complemental strand, 31109984 - 31109793
Alignment:
| Q |
29 |
agatatagaacttgagttcaatttacttggtagtcacggaccaatattggttggttctccaagaatctaatgttctgcttcnnnnnnnn------aactg |
122 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31109984 |
agatatagaagttgagttcaatttacttggtagtcacggaccaatattggttggttctccaagaatctaatgttctgctttttttttttttttttaactg |
31109885 |
T |
 |
| Q |
123 |
aaactgttatttcatcgcttgttaagtaccatgctgatatgccgatatgcaagcacaagttgatacaagctgtaaattgtaatttgtactac |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31109884 |
aaactgttatttcatcgcttgttaagtaccatgctgatatgccgatatgcaagcacaagttgatacaagctgtgaattgtaatttgtactac |
31109793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 31 - 108
Target Start/End: Complemental strand, 31080169 - 31080096
Alignment:
| Q |
31 |
atatagaacttgagttcaatttacttggtagtcacggaccaatattggttggttctccaagaatctaatgttctgctt |
108 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||| |||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
31080169 |
atatagaagttgagttcaatttacttggtggtcatggaccagta----ttggttctccaagaatctaatgttctgctt |
31080096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University