View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1781_low_7 (Length: 268)
Name: NF1781_low_7
Description: NF1781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1781_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 36 - 259
Target Start/End: Complemental strand, 42302945 - 42302722
Alignment:
| Q |
36 |
aaaaacgccttatgaaagatttttgtttgtgaagtgtactccaatttagcatctcgataattagtcgacatatattgatattattatataaggctggcga |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42302945 |
aaaaacgccttatgaaagatttttgtttgtgaagtgtactccaatttagcatctcgataattagtcgacatatattgatattattatataaggctggcgg |
42302846 |
T |
|
| Q |
136 |
gctatgttaactatttgaattactcattcatattgacatttagagtaacgtccctaagcattttggaacggtgatgacccaatttggatttgatctaagg |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42302845 |
gctatgttaactatttgaattactcattcatattgacatttagagtaacgtccctaagcattttggaacggtgatgacccaatttggatttgatctaagg |
42302746 |
T |
|
| Q |
236 |
tgcaggctgtgagaacagaataat |
259 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
42302745 |
tgcaggctgtgagaacagaataat |
42302722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University