View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17821_high_19 (Length: 270)
Name: NF17821_high_19
Description: NF17821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17821_high_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 20 - 259
Target Start/End: Complemental strand, 24624891 - 24624650
Alignment:
| Q |
20 |
aaaacctggaaaaactagtgggcaattaggtttaactcttggttggattccattctcaa--accatcttaatctcattagctattactcgagctatgtcc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24624891 |
aaaacctggaaaaactagtgggcaattaggtttaactcttggttggattccattctcaacaaccatcttaatctcattagctattactcgagctatgtcc |
24624792 |
T |
|
| Q |
118 |
acttgtctacccacaaggatataatgaagaaggtagacgatatcaagagaagcgatggaggtatggctgtgtcgtcagatgttgtggaggataaggtgga |
217 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
24624791 |
acttgtctaccgacaaggatataatgaagaaggtagacgatatcaagagaagcgatggaggtatggctgcgtcgtcggatgttgtggaggataaggtgga |
24624692 |
T |
|
| Q |
218 |
taatcacttgagtttgggggttcatatcatcctttgctactc |
259 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
24624691 |
taatcacttgagtttgggtgttcatatcatcctttgcaactc |
24624650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University