View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17821_high_21 (Length: 253)
Name: NF17821_high_21
Description: NF17821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17821_high_21 |
 |  |
|
| [»] scaffold0035 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 8)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 57 - 240
Target Start/End: Complemental strand, 8891497 - 8891316
Alignment:
| Q |
57 |
ttcactaaaagatgtttatcatattctagtgcatagagagaagcacgacaatgattctcattcaaacttaatatggaacaaaccagtgcccctcgaagtc |
156 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8891497 |
ttcattaaaagatgtttatcatattctagcgcatagagagaagcacgacaatgattctcattcaaacttaatatggaacaaaccagtgcccctcgaagtc |
8891398 |
T |
 |
| Q |
157 |
tttttattagcgtggagaactctgaacaagaggatttcgataaaagagaatttggtacgccgtggagtggttcccttaggttct |
240 |
Q |
| |
|
||||||||| ||| |||||| |||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8891397 |
tttttatta--gtgaagaactatgaacaagaggatttcaataaattagaatttggtacgccgtggagtggttcccttaggttct |
8891316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 57
Target Start/End: Original strand, 12880742 - 12880782
Alignment:
| Q |
17 |
aaattgcccatgagttttcaaaggcaacctaggcctcacct |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12880742 |
aaattgcccatgagttttcaaaggcaacctaggcctcacct |
12880782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 17 - 56
Target Start/End: Complemental strand, 1656167 - 1656128
Alignment:
| Q |
17 |
aaattgcccatgagttttcaaaggcaacctaggcctcacc |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1656167 |
aaattgcccatgagttttcaaaggcaacctaggcctcacc |
1656128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 17 - 56
Target Start/End: Complemental strand, 6334106 - 6334067
Alignment:
| Q |
17 |
aaattgcccatgagttttcaaaggcaacctaggcctcacc |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6334106 |
aaattgcccatgagttttcaaaggcaacctaggcctcacc |
6334067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 17 - 57
Target Start/End: Original strand, 37404695 - 37404735
Alignment:
| Q |
17 |
aaattgcccatgagttttcaaaggcaacctaggcctcacct |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37404695 |
aaattgcccatgagttttcaaaggcaacctaggtctcacct |
37404735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 17 - 58
Target Start/End: Complemental strand, 24512832 - 24512791
Alignment:
| Q |
17 |
aaattgcccatgagttttcaaaggcaacctaggcctcacctt |
58 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
24512832 |
aaattgcccatgaattttcaaagacaacctaggcctcacctt |
24512791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 17 - 58
Target Start/End: Complemental strand, 413428 - 413387
Alignment:
| Q |
17 |
aaattgcccatgagttttcaaaggcaacctaggcctcacctt |
58 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
413428 |
aaattacccatgaattttcaaaggcaacctagggctcacctt |
413387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 57
Target Start/End: Complemental strand, 36797685 - 36797646
Alignment:
| Q |
17 |
aaattgcccatgagttttcaaaggcaacctaggcctcacct |
57 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
36797685 |
aaattgcccatgagttttcaaagacaa-ctaggcctcacct |
36797646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 17 - 58
Target Start/End: Complemental strand, 22158606 - 22158565
Alignment:
| Q |
17 |
aaattgcccatgagttttcaaaggcaacctaggcctcacctt |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22158606 |
aaattgcccatgagttttcaaaggcaacctaggcctcacctt |
22158565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 19 - 58
Target Start/End: Original strand, 45719896 - 45719935
Alignment:
| Q |
19 |
attgcccatgagttttcaaaggcaacctaggcctcacctt |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45719896 |
attgcccatgagttttcaaaggcaacctaggcctcacctt |
45719935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 57
Target Start/End: Complemental strand, 25920222 - 25920182
Alignment:
| Q |
17 |
aaattgcccatgagttttcaaaggcaacctaggcctcacct |
57 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
25920222 |
aaattgcccatgagtcttcaaaggcaacctaggtctcacct |
25920182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 17 - 56
Target Start/End: Complemental strand, 51754465 - 51754426
Alignment:
| Q |
17 |
aaattgcccatgagttttcaaaggcaacctaggcctcacc |
56 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
51754465 |
aaattgcccatgaatttttaaaggcaacctaggcctcacc |
51754426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 17 - 58
Target Start/End: Complemental strand, 3805234 - 3805193
Alignment:
| Q |
17 |
aaattgcccatgagttttcaaaggcaacctaggcctcacctt |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3805234 |
aaattgcccatgagttttcaaaggcaacctaggcctcacctt |
3805193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 17 - 58
Target Start/End: Complemental strand, 37974853 - 37974812
Alignment:
| Q |
17 |
aaattgcccatgagttttcaaaggcaacctaggcctcacctt |
58 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37974853 |
aaattgcccatgagtcttcaaaggcaacctaggcctcacctt |
37974812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 57
Target Start/End: Original strand, 39755385 - 39755425
Alignment:
| Q |
17 |
aaattgcccatgagttttcaaaggcaacctaggcctcacct |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39755385 |
aaattgcccatgagttttcaaaggcaacctaggcctcacct |
39755425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 194
Target Start/End: Original strand, 3868978 - 3869062
Alignment:
| Q |
110 |
attctcattcaaacttaatatggaacaaaccagtgcccctcgaagtctttttattagcgtggagaactctgaacaagaggatttc |
194 |
Q |
| |
|
|||||||||||||| | ||||||||||| || || ||| |||| ||| ||||||||||||||||| | |||||||||||||| |
|
|
| T |
3868978 |
attctcattcaaacattctatggaacaaagttgtacctctcaaagtttttctattagcgtggagaactatcaacaagaggatttc |
3869062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 17 - 56
Target Start/End: Original strand, 5098410 - 5098449
Alignment:
| Q |
17 |
aaattgcccatgagttttcaaaggcaacctaggcctcacc |
56 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
5098410 |
aaattgcccatgaattttcaaaggcaacctatgcctcacc |
5098449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 17 - 56
Target Start/End: Complemental strand, 80082 - 80043
Alignment:
| Q |
17 |
aaattgcccatgagttttcaaaggcaacctaggcctcacc |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
80082 |
aaattgcccatgagttttcaaaggcaacctaggcctcacc |
80043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 17 - 56
Target Start/End: Original strand, 31174100 - 31174139
Alignment:
| Q |
17 |
aaattgcccatgagttttcaaaggcaacctaggcctcacc |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31174100 |
aaattgcccatgagttttcaaaggcaacctaggcctcacc |
31174139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 56
Target Start/End: Original strand, 28396490 - 28396529
Alignment:
| Q |
17 |
aaattgcccatgagttttcaaaggcaacctaggcctcacc |
56 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28396490 |
aaattgcccataagttttcaaaggcaacctaggcctcacc |
28396529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 53
Target Start/End: Original strand, 27265689 - 27265725
Alignment:
| Q |
17 |
aaattgcccatgagttttcaaaggcaacctaggcctc |
53 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27265689 |
aaattgtccatgagttttcaaaggcaacctaggcctc |
27265725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 17 - 56
Target Start/End: Complemental strand, 24089394 - 24089355
Alignment:
| Q |
17 |
aaattgcccatgagttttcaaaggcaacctaggcctcacc |
56 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
24089394 |
aaattgaccatgaattttcaaaggcaacctaggcctcacc |
24089355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 17 - 58
Target Start/End: Complemental strand, 13845033 - 13844992
Alignment:
| Q |
17 |
aaattgcccatgagttttcaaaggcaacctaggcctcacctt |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13845033 |
aaattgcccatgagttttcaaaggcaacctaggtctcacctt |
13844992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University