View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17821_high_24 (Length: 239)
Name: NF17821_high_24
Description: NF17821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17821_high_24 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 15 - 239
Target Start/End: Complemental strand, 15695203 - 15694979
Alignment:
| Q |
15 |
aatatcccttgacttttctaaaatatctatcaatacaaacacatgaagagtggacttggtaaacataaattcatgactcaaattttctatcattacagca |
114 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15695203 |
aatatcctttgacttttctaaaatatctatcaatacaaacacatgaagagtggacttggtaaacataaattcatgactcaaattttctatcattacagca |
15695104 |
T |
 |
| Q |
115 |
tcatttgctttggacttctaaatataatagctcaattatcattacaacatcattggcactaattggaatcatgcaataggaacatagtactccatggaag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15695103 |
tcatttgctttggacttctaaatataatagctcaattatcattacaacatcattggcaataattggaatcatgcaataggaacatagtactccatggaag |
15695004 |
T |
 |
| Q |
215 |
gaagaaaactaaacttgacatcaat |
239 |
Q |
| |
|
|||||||||||||||||| |||||| |
|
|
| T |
15695003 |
gaagaaaactaaacttgagatcaat |
15694979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University