View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17821_high_26 (Length: 232)
Name: NF17821_high_26
Description: NF17821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17821_high_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 16 - 215
Target Start/End: Complemental strand, 3283698 - 3283499
Alignment:
| Q |
16 |
aatatttaggtcaactcccatcgtgtctgtttgcctgcatttctagaaattaggttcaaggaatcgaacctagaaccataaattgatgtatattgatcaa |
115 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3283698 |
aatatttgggtcaactcccatcgtgtctgtttgcctgcatttctagaaattaggttcaaggaatcgaacctagaaccataaattgatgtatattgatcaa |
3283599 |
T |
|
| Q |
116 |
aatagtaattattaggcaaaaatcagagattttctatgacagtaatatctcttactttttatgtgctttctagaggcgaacattattatttcttattttt |
215 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3283598 |
aatagtaattattaagcaaaaatcagagattttctatgacagtattatctcttactttttatgtgctttctagaggcgaacattattatttcttattttt |
3283499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 114 - 215
Target Start/End: Complemental strand, 1175640 - 1175542
Alignment:
| Q |
114 |
aaaatagtaattattaggcaaaaatcagagattttctatgacagtaatatctcttactttttatgtgctttctagaggcgaacattattatttcttattt |
213 |
Q |
| |
|
|||||||||| |||||||||||| |||||| |||||||||||| || | ||||||| ||||| ||| ||| ||||| | |||||||||||||||||||| |
|
|
| T |
1175640 |
aaaatagtaagtattaggcaaaattcagagtttttctatgaca-tattgtctcttaatttttctgt--tttgtagagacaaacattattatttcttattt |
1175544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 114 - 156
Target Start/End: Complemental strand, 18633987 - 18633945
Alignment:
| Q |
114 |
aaaatagtaattattaggcaaaaatcagagattttctatgaca |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18633987 |
aaaatagtaattattaggcaaaaatcagagtttttctatgaca |
18633945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 62 - 107
Target Start/End: Complemental strand, 4701303 - 4701258
Alignment:
| Q |
62 |
aaattaggttcaaggaatcgaacctagaaccataaattgatgtata |
107 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||| |||||||||| |
|
|
| T |
4701303 |
aaattaagtttaaggaatcaaacctagaaccataacttgatgtata |
4701258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 71 - 107
Target Start/End: Complemental strand, 1175780 - 1175744
Alignment:
| Q |
71 |
tcaaggaatcgaacctagaaccataaattgatgtata |
107 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
1175780 |
tcaagtaatcgaacctagaactataaattgatgtata |
1175744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University