View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17821_low_22 (Length: 255)
Name: NF17821_low_22
Description: NF17821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17821_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 3325244 - 3325023
Alignment:
| Q |
18 |
caacccaacttaactgaattacaagatgaacttatccgctatggcannnnnnnaatctatttctagtcattgtttaatctcttattgtaacgtttgttat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3325244 |
caacccaacttaactgaattacaagatgaacttatccgttatggcatttttttaatctatttctagtcattgtttaatctcttattgtaacgtttgttat |
3325145 |
T |
|
| Q |
118 |
atgaatctttctcattgattatatatttggttcttttaacttacttgcattannnnnnncttttgcggctctatataaacccactgttttcaagtccctc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3325144 |
atgaatctttctcattgattatatatttggttcttttaacttacctgcatta-ttttttcttttgcggctctatataaacccactgttttcaagtccctc |
3325046 |
T |
|
| Q |
218 |
caaattatatgcgtccctctgtg |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3325045 |
caaattatatgcgtccctctgtg |
3325023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University