View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17821_low_29 (Length: 220)
Name: NF17821_low_29
Description: NF17821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17821_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 15 - 205
Target Start/End: Complemental strand, 37998441 - 37998251
Alignment:
| Q |
15 |
agagatacaagatggctaaactatcagacattcatcaccaagctagactttggtgatagtcgctattccgattccttcccttcacgaatctgcactcact |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37998441 |
agagatacaagatggctaaactatcagacattcatcaccaagctagactttggtgatattcgctattccgattccttcccttcacaaatctgcactcact |
37998342 |
T |
|
| Q |
115 |
gcaaagttagttgttactctgctttctatgtctctgataaggttacttacttttctattcttcctcttgctatcttctttcatgctaaact |
205 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37998341 |
gcaaagttagttgttactctgctttctctgtctctgataaggttacttacttttctattcttcctcttgctctcttctttcatgctaaact |
37998251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University