View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17822_low_5 (Length: 324)
Name: NF17822_low_5
Description: NF17822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17822_low_5 |
 |  |
|
| [»] scaffold0114 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0114 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: scaffold0114
Description:
Target: scaffold0114; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 315
Target Start/End: Complemental strand, 5980 - 5666
Alignment:
| Q |
1 |
gtgcggtctctaaacatatgtccattcttcatgatggggataatgtcatctcggacccaattgagatagaggaccatgttgtgtcatattttcagtctat |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5980 |
gtgcggtttctaaacatatgtccattcttcatgatagggataatgtcatctcggacccaattgagatagaggagcatgttgtgtcatattttcagtctat |
5881 |
T |
 |
| Q |
101 |
ttttagcgttgataatgattgtggggctaataatatggtagagcaattggttccaagattggttacggaggctgagaatgatttattatgttgcttacct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |||||| |
|
|
| T |
5880 |
ttttagcgttgataatgattgtggggctaataatatggtagagcaattggttccaagattggttacggaggctgagactgatttattatgtcgtttacct |
5781 |
T |
 |
| Q |
201 |
gtgatgtctgaaataaagtctgcggtttttcatcttaatgatgatagtgcgccgggtccagacgggtttggtgggcatttttacaagacgttttgggaca |
300 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
5780 |
atgatgtctgaaataaagtctgcggtttttgatcttaatggtgatagtgcgccgggtcctgacgggtttggtgggcatttttactagacattttgggaca |
5681 |
T |
 |
| Q |
301 |
ttatttttgttgatg |
315 |
Q |
| |
|
|||||| || ||||| |
|
|
| T |
5680 |
ttatttctgctgatg |
5666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University