View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17823_low_6 (Length: 224)
Name: NF17823_low_6
Description: NF17823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17823_low_6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 63 - 224
Target Start/End: Original strand, 54395375 - 54395536
Alignment:
| Q |
63 |
ttgatacatcttagcaataataggattacaaattccttccaactccttctgcttatcctcaaactcatccacttccgccatttgattcccctccaaccac |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54395375 |
ttgatacatcttagcaataataggattacaaattccttccaactccttctgcttatcctcaaactcatccacttccgccatttgattcccctccaaccac |
54395474 |
T |
|
| Q |
163 |
tgtatagcatcttccacagccttctcaatcttctccttatcatcatgactcaacttcccacc |
224 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
54395475 |
tgtattgcatcttccacagccttctcaatcttctccttatcttcatgactcaacttcccacc |
54395536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University