View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17824_high_6 (Length: 388)
Name: NF17824_high_6
Description: NF17824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17824_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 1 - 372
Target Start/End: Original strand, 46894732 - 46895103
Alignment:
| Q |
1 |
aatgtcagtagaaaaacagtataagaacatagcaacgaaacagacctggaagaccagaaggaatggaccatgtgaatgaatcgaagaattcagtaatatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46894732 |
aatgtcagtagaaaaacagtataagaacatagcaacgaaacagacctggaagaccagaaggaatggaccatgtgaatgaatcgaagaattcagtaatatt |
46894831 |
T |
 |
| Q |
101 |
aacgtcaggaaacttttctttgacatagcgttcaacggaaagcttgcttttaaatataatcgagcttcggtttgcaacaagacgatgaggaacatacaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46894832 |
aacgtcaggaaacttttctttgacatagcgttcaacggaaagcttgcttttaaatataatcgagcttcggtttgcaacaagacgatgaggaacatacaga |
46894931 |
T |
 |
| Q |
201 |
taccggtctcgataattaccgttatttgaaatcctcttaccggatttccatcgccaaatgtcaccgggattcggaaaattctccggcgcatagggtaaac |
300 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46894932 |
taccggtctcgatagttaccgttatttgaaatcctcttaccggatttccatcgccaaatgtcaccgggattcggaaaattctccggcgcatagggtaaac |
46895031 |
T |
 |
| Q |
301 |
cttcgccggattgttcaggtgccaccggcgcaacaagatttgacgagttgctgccaccattgctagccacag |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46895032 |
cttcgccggattgttcaggtgccaccggcgcaacaagatttgacgagttgctgccaccattgctagccacag |
46895103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University