View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17824_low_15 (Length: 284)
Name: NF17824_low_15
Description: NF17824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17824_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 50 - 234
Target Start/End: Original strand, 21431524 - 21431708
Alignment:
| Q |
50 |
tttctatgatttttctttgtgcgtttctcgatattgcaaagaatcacgtttttcagtaatagtccaattgtgaaatctgatttgaatagtgcaatgttcg |
149 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21431524 |
tttctatgatttttctttgtgtgtttctcgatattgcaaagaatcacgtttttcagtaatagtccaattgtgaaatctgatttgaatagtgcaatgttcg |
21431623 |
T |
 |
| Q |
150 |
atattgcaaagaattgtgttcttgatgttgaatagaattgcgtnnnnnnnctgtgatgttgcttcttgttctatttttgagaaat |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
21431624 |
atattgcaaagaattgtgttcttgatgttcaatagaattgcgtaaaaaaactctgatgttgtttcttgttctatttttgagaaat |
21431708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 71 - 123
Target Start/End: Complemental strand, 27102160 - 27102109
Alignment:
| Q |
71 |
cgtttctcgatattgcaaagaatcacgtttttcagtaatagtccaattgtgaa |
123 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| | |||||||||| |
|
|
| T |
27102160 |
cgtttctcgatattgcaaagaatcacg-ttttcagtaatgattcaattgtgaa |
27102109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University