View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17826_high_15 (Length: 279)
Name: NF17826_high_15
Description: NF17826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17826_high_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 178 - 271
Target Start/End: Original strand, 42895649 - 42895742
Alignment:
| Q |
178 |
atgactcaaaccttcataaaggtttgctctcatttgtgtttattcacctatcaatgtatctcgtttcccttcatgcccattttcctattcatct |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42895649 |
atgactcaaaccttcataaaggtttgctctcatttgtgtttattcacctatcaatgtatctcgtttcccttcatgcccattttcctattcatct |
42895742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 31 - 82
Target Start/End: Original strand, 42895516 - 42895567
Alignment:
| Q |
31 |
cctcccccttccttagctaaataaaattattttgataatttgatgtgttttg |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42895516 |
cctcccccttccttagctaaataaaattattttgatcatttgatgtgttttg |
42895567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University