View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17826_high_22 (Length: 226)
Name: NF17826_high_22
Description: NF17826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17826_high_22 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 5875274 - 5875499
Alignment:
| Q |
1 |
cattcgtttctcaattacatccaaacaaaccacgtcccatacttctttgctgaactgacatccaaacagaagatggattgtttgttcgacactattgtca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5875274 |
cattcgtttctcaattacatccaaacaaaccacgtcccatacttctttgttgaactgacatccaaacagaagatcgattgtttgttcgacactattgtca |
5875373 |
T |
 |
| Q |
101 |
caaacagggcagctaccaggacagttagcacccctctcttgcaacttctttcgcgtagacaaacaatctcgacaaactcttcaaataacattccgcgatt |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5875374 |
caaacagggcagctactaggacagttagcacccctctcttgcaacttctttcgcatatacaaacaatctcgacaaactcttcaaataagattccgcgatt |
5875473 |
T |
 |
| Q |
201 |
taatcctcgaaatccgagtaggcgat |
226 |
Q |
| |
|
|||||||| |||||||||||| |||| |
|
|
| T |
5875474 |
taatcctccaaatccgagtagacgat |
5875499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University