View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17826_high_4 (Length: 453)
Name: NF17826_high_4
Description: NF17826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17826_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 347; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 1 - 371
Target Start/End: Complemental strand, 34104212 - 34103842
Alignment:
| Q |
1 |
aaaatgggataacgttgcatcattagctttcgaggagctcaaaacaaccatcacattggtactgaacattgattcctccggctccgggtaaagtattgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34104212 |
aaaatgggataacgttgcatcattagctttcgaggagctcaaaacaaccatcacattggtactgaacattgattcctccggctccgggtaaagtattgct |
34104113 |
T |
|
| Q |
101 |
tacttcttcaaaaaatcgagtcataggatgcaaaagcaataaacttatgtgtgggaatcatatgcaatttttgaagcaatgggaaagtttcaacattact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34104112 |
tacttcttcaaaaaatcgagtcataggatgcaaaagcaataaacttatgtgtgggaatcatatgcaatttttgaagcaatgggaaagtttcaacattact |
34104013 |
T |
|
| Q |
201 |
taatttgtcacaagttcatcattagacttttcaaaaagtcatgaagtctagcactgaccaagctgttcagatcacatgatcagaaacaagttcactattg |
300 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34104012 |
taatttgtcacaagttcattatgagacttttcaaaaagtcgtgaagtctagcactgaccaagctgttcagatcacatgatcagaaacaagttcattattg |
34103913 |
T |
|
| Q |
301 |
ttaagaatgataatgaaggataggttttgttaatgaggttgagaatgaaacaaaagtcttacttccaccta |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34103912 |
ttaagaatgataatgaaggataggttttgttgatgaggttgagaatgaaacacaagtcttacttccaccta |
34103842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University