View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17826_low_16 (Length: 290)
Name: NF17826_low_16
Description: NF17826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17826_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 18 - 278
Target Start/End: Original strand, 11485514 - 11485774
Alignment:
| Q |
18 |
gaggagtgtgatgcgcaggaggggcaacgaaggtagtgggggtgtggttgtgtgtgtggcattatggggctcgatgtcgcattcctattcttttcgtcca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11485514 |
gaggagtgtgatgcgcaggaggggcaacgaaggtagtgggggtgtggttgtgtgtgtggcgttatggggctcgatgtcgcattcctattcttttcgtcca |
11485613 |
T |
 |
| Q |
118 |
tctctgggagcgtatggcgggttgttggttatgtgggattcttcaatagtagaggtgtggacctcgtgtagtatggagcatatgttgattattcatgacc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11485614 |
tctctgggagcgtatggcgggttgttggttatgtgggattcttcaatagtagagatctggacctcgtgtagtatggagcatgtgttgattattcatgacc |
11485713 |
T |
 |
| Q |
218 |
gctttactcactctaatgaagatttatatttaatttgtttaatatttatgacccttgtgat |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11485714 |
gctttactcactctaatgaagatttatatttaatttgtttaatatttatgaccctcgtgat |
11485774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University