View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17826_low_17 (Length: 289)

Name: NF17826_low_17
Description: NF17826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17826_low_17
NF17826_low_17
[»] chr2 (1 HSPs)
chr2 (26-272)||(16638005-16638256)


Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 26 - 272
Target Start/End: Original strand, 16638005 - 16638256
Alignment:
26 tttggcgagttgaaaattttgttttgatcactctttttggcaagtggcagtgatggctaacaaacaggtacactttggcaacaggtattagaagcaaaac 125  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
16638005 tttggcgagttgaaaattttgttttgatcactctttttggcaagtggcagtgatggctaacaaacaggtacactttggcaacaggtattaaaagcaaaac 16638104  T
126 aagttgaatttttgtgttctttaacaaaattgaacgaggtcgatagatccttatgtgtctgtcgacttggtggaaagg-----atttgtatgctattgga 220  Q
    ||||||||||| ||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||    
16638105 aagttgaatttctgtcttctataacaaaattgaacgaggtcgatagatccttatgtgtctgtcgacttggtggaaaggatttaatttgtatgctattgga 16638204  T
221 tggagtttatattcaaggaagattttatcattgatattttgtgtttctattc 272  Q
    ||||||||||| | |||||||||||||||||| |||||||||||||||||||    
16638205 tggagtttatactgaaggaagattttatcatttatattttgtgtttctattc 16638256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University