View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17826_low_17 (Length: 289)
Name: NF17826_low_17
Description: NF17826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17826_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 26 - 272
Target Start/End: Original strand, 16638005 - 16638256
Alignment:
| Q |
26 |
tttggcgagttgaaaattttgttttgatcactctttttggcaagtggcagtgatggctaacaaacaggtacactttggcaacaggtattagaagcaaaac |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16638005 |
tttggcgagttgaaaattttgttttgatcactctttttggcaagtggcagtgatggctaacaaacaggtacactttggcaacaggtattaaaagcaaaac |
16638104 |
T |
 |
| Q |
126 |
aagttgaatttttgtgttctttaacaaaattgaacgaggtcgatagatccttatgtgtctgtcgacttggtggaaagg-----atttgtatgctattgga |
220 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16638105 |
aagttgaatttctgtcttctataacaaaattgaacgaggtcgatagatccttatgtgtctgtcgacttggtggaaaggatttaatttgtatgctattgga |
16638204 |
T |
 |
| Q |
221 |
tggagtttatattcaaggaagattttatcattgatattttgtgtttctattc |
272 |
Q |
| |
|
||||||||||| | |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16638205 |
tggagtttatactgaaggaagattttatcatttatattttgtgtttctattc |
16638256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University