View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17826_low_19 (Length: 279)

Name: NF17826_low_19
Description: NF17826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17826_low_19
NF17826_low_19
[»] chr7 (2 HSPs)
chr7 (178-271)||(42895649-42895742)
chr7 (31-82)||(42895516-42895567)


Alignment Details
Target: chr7 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 178 - 271
Target Start/End: Original strand, 42895649 - 42895742
Alignment:
178 atgactcaaaccttcataaaggtttgctctcatttgtgtttattcacctatcaatgtatctcgtttcccttcatgcccattttcctattcatct 271  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42895649 atgactcaaaccttcataaaggtttgctctcatttgtgtttattcacctatcaatgtatctcgtttcccttcatgcccattttcctattcatct 42895742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 31 - 82
Target Start/End: Original strand, 42895516 - 42895567
Alignment:
31 cctcccccttccttagctaaataaaattattttgataatttgatgtgttttg 82  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||    
42895516 cctcccccttccttagctaaataaaattattttgatcatttgatgtgttttg 42895567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University