View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17826_low_23 (Length: 238)
Name: NF17826_low_23
Description: NF17826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17826_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 3 - 129
Target Start/End: Original strand, 22080457 - 22080583
Alignment:
| Q |
3 |
acaaaatagaaatgcagttcaatagatctttgatatgtctttgattaaaatgacttctgaaacaattttagttcgaaaaattgatttaatgcaagaagga |
102 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||| ||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22080457 |
acaaaacagaaatgcagttcaatagatctttgatacgtctttcattaaaatgacttctcaaacaattttagttcgaaaaactgatttaatgcaagaagga |
22080556 |
T |
|
| Q |
103 |
aaaccgatctattgaaatgttgttcac |
129 |
Q |
| |
|
||||||||||||| || |||||||||| |
|
|
| T |
22080557 |
aaaccgatctatttaagtgttgttcac |
22080583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University