View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17826_low_27 (Length: 223)
Name: NF17826_low_27
Description: NF17826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17826_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 84 - 202
Target Start/End: Complemental strand, 10526738 - 10526613
Alignment:
| Q |
84 |
catatcagttctctgatcttggctgctaaaagtccgttcttctataaggcagaccaagatctctatatctt-------tacattgtatagttttgccaaa |
176 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||||| |||||||| |||||||||||| |||||||||||||| ||||||| |
|
|
| T |
10526738 |
catatcagttctccgatcttggctgctaaaagcccgttcttctataaggtagaccaagttctctatatctttatattgtacattgtatagttctgccaaa |
10526639 |
T |
|
| Q |
177 |
aatttgttttcttagcagtgtttatt |
202 |
Q |
| |
|
||| |||||||||||||||||||||| |
|
|
| T |
10526638 |
aatatgttttcttagcagtgtttatt |
10526613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 19 - 85
Target Start/End: Complemental strand, 10526826 - 10526760
Alignment:
| Q |
19 |
cataggtgatgaggttgtaaaagacaatgatgaacccaacctgggcatggattactctgaagctgca |
85 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10526826 |
cataggtgatgaggctgtaaacgacaatgatgaacccaacctgggcatggattactctgaacctgca |
10526760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 85
Target Start/End: Original strand, 923874 - 923940
Alignment:
| Q |
19 |
cataggtgatgaggttgtaaaagacaatgatgaacccaacctgggcatggattactctgaagctgca |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
923874 |
cataggtgatgaggttgtaaaagacaatgatgaacctaacctgggcatggattgctctgaagctgca |
923940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University