View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17826_low_29 (Length: 213)
Name: NF17826_low_29
Description: NF17826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17826_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 42895506 - 42895325
Alignment:
| Q |
19 |
aggtggaaaaaaggttggcatttatcatctgacgtaatatctccgtcattatgctcaactgtctcaattactcttgcatttatgtgatttaaatggtctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42895506 |
aggtggaaaaaaggttggcatttatcatctgacgtaatatctccgtcattatgctcaactgtctcaattactcttgcatttatgtgatttaaatggtctt |
42895407 |
T |
 |
| Q |
119 |
aatagaatggcca-nnnnnnnncaatgcttggaactacccaacccaacccactctctataccatccattgttttgtagtttt |
199 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42895406 |
aatagaatggccatttttttttcaatgcttggaactacccaacccaacccactctctataccatcctttgttttgtagtttt |
42895325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 54 - 124
Target Start/End: Original strand, 25581381 - 25581451
Alignment:
| Q |
54 |
aatatctccgtcattatgctcaactgtctcaattactcttgcatttatgtgatttaaatggtcttaataga |
124 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25581381 |
aatatctccttcattattctcaactgtctcaattactcttgcatttatgtgatttaaatggtcttaataga |
25581451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University