View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17828_high_47 (Length: 229)
Name: NF17828_high_47
Description: NF17828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17828_high_47 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 83 - 211
Target Start/End: Complemental strand, 18697859 - 18697731
Alignment:
| Q |
83 |
tgaaatggtataatcctttcaaataatattcacatggcaacgaggatttaatgacttttcaaatgactaaactttcccttagacatttcaaggaaaaagc |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| || || |||||||||| |||| |
|
|
| T |
18697859 |
tgaaatggtataatcctttcaaataatattcacatggcaactatgatttaatgacttttcaaatgactaaactttccattggatgtttcaaggaacaagc |
18697760 |
T |
 |
| Q |
183 |
ggaggaatcaaagaggttaagagtgcaac |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18697759 |
ggaggaatcaaagaggttaagagtgcaac |
18697731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 18699881 - 18699926
Alignment:
| Q |
1 |
attattctctatgtagattgcctatttgatgataaattattatatt |
46 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18699881 |
attattctttatgtagattgcctatttgatgataaattattatatt |
18699926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University