View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17828_high_55 (Length: 208)
Name: NF17828_high_55
Description: NF17828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17828_high_55 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 13 - 189
Target Start/End: Complemental strand, 41096034 - 41095858
Alignment:
| Q |
13 |
gagtgaaatgaaataaatatgcaaaagataagagagtggnnnnnnnn-ttgtactttgataaggaattccaaagtaaaataacaacaaaaagatttgcac |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41096034 |
gagttaaatgaaataaatatgcaaaagataagagagtggaaaaaaaaattgtactttgataaggaattccaaagtaaaataacaacaaaaagatttgcac |
41095935 |
T |
|
| Q |
112 |
taaaacctacaaaactaggacaatagtttagactgatgctctcaacagggggtgctgcaaagtccaaagtatctttct |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41095934 |
taaaacctacaaaactaggacaatagtttagactgatgctctcaaca-ggggtgctgcaaagtccaaagtatctttct |
41095858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University