View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17828_low_21 (Length: 332)
Name: NF17828_low_21
Description: NF17828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17828_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 108 - 322
Target Start/End: Original strand, 45783079 - 45783280
Alignment:
| Q |
108 |
tagtgtattgaatgtaacgggattggaggtggtgaattttgtagtttagtgattgattttgtgcgtgcttatcccacttgtcttcatttcctaaactata |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45783079 |
tagtgtattgaatgtaacgggattggaggtggtgaattttgtagtttagtgattgatattgtgcgtgcttatcccacttgtcttcatttcctaaactata |
45783178 |
T |
|
| Q |
208 |
gcatagccttttcatttccactcagctcaacacacacacgctctcactcactccctttctcttattattagtatagtattaaccatcatcctcatccctt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||| |||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
45783179 |
gcatagccttttcatttccactcagctcaacaca--------cgcactcactctctttctcttattat-----tattattaaccatcatcctcatccctt |
45783265 |
T |
|
| Q |
308 |
tcagatctccctctc |
322 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
45783266 |
tcagatctctctctc |
45783280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 53 - 84
Target Start/End: Original strand, 45783021 - 45783052
Alignment:
| Q |
53 |
cgtaacaagttgttatatttaattagaaccca |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45783021 |
cgtaacaagttgttatatttaattagaaccca |
45783052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University