View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17828_low_28 (Length: 302)
Name: NF17828_low_28
Description: NF17828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17828_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 3424718 - 3424489
Alignment:
| Q |
1 |
ttaaatgtaatcacatgtgtcgatcttgttggacataaacacacgtcagacactcttagatcataaacaaggttttaaatacgggtccattacctgtttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3424718 |
ttaaatgtaatcacatgtgtcgatcttgttggacataaacgcacgtcagacactcttagatcataaacaaggttttaaatacgggtccattacctgtttt |
3424619 |
T |
|
| Q |
101 |
caggatgagaaatcacagcaaaacatttgttaccatcatcacaaaaccttgatatggccataaaaactctgttacgagtgtgacacaccatcatggaagc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3424618 |
caggatgagaaatcacagcaaaacatttgttaccatcatcacaaaaccttgatatggccataaaaactctgttacgaatgtgacacaccatcatggaagc |
3424519 |
T |
|
| Q |
201 |
gaaaaacattcattttccttcctgcctcta |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3424518 |
gaaaaacattcattttccttcctgcctcta |
3424489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 227 - 285
Target Start/End: Complemental strand, 3424198 - 3424140
Alignment:
| Q |
227 |
tctaaagtaaatgaaaaaacggttggccttcttttatattgactaaaccatacaatttc |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3424198 |
tctaaagtaaatgaaaaaacggttggccttcttttatattgactaaaccatacaatttc |
3424140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 43578800 - 43578845
Alignment:
| Q |
163 |
aaaactctgttacgagtgtgacacaccatcatggaagcgaaaaaca |
208 |
Q |
| |
|
|||||| |||||||| || |||||||||| |||||||||||||||| |
|
|
| T |
43578800 |
aaaactttgttacgaatgcgacacaccattatggaagcgaaaaaca |
43578845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University