View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17828_low_33 (Length: 279)
Name: NF17828_low_33
Description: NF17828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17828_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 48019131 - 48019387
Alignment:
| Q |
1 |
tatccaaagaccaaaaatagagacaattagagcaaacaaagcaatatgaaatgatgattaattaatactaatacacacctcatgtccctcgccgttatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48019131 |
tatccaaagaccaaaaatagagacaattagagcaaacaaagcaatatgaaatgatgatta----atactaatacacacctcatgtccctctccgttatta |
48019226 |
T |
|
| Q |
101 |
acaacttcagggggctcattgcgacggaataaaagtggtgaccgtcgttgtttcttcccatattcatacaaagatttagctctcaacacatcatgcaccg |
200 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48019227 |
acaacttctgggggctcattgcgaccgaataaaagttgtgaccgtcgttgtttcttcccatattcatacaaagatttagctctcaacacatcatgcaccg |
48019326 |
T |
|
| Q |
201 |
tgctccgccgtatcggtacagttccttttggacaacgtgtcccattttggtgccacatttg |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48019327 |
tgctccgccgtatcggtacagttccttttggacaacgtgtcccattttggtgccacatttg |
48019387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 150 - 261
Target Start/End: Complemental strand, 35407175 - 35407064
Alignment:
| Q |
150 |
gtttcttcccatattcatacaaagatttagctctcaacacatcatgcaccgtgctccgccgtatcggtacagttccttttggacaacgtgtcccattttg |
249 |
Q |
| |
|
||||||| ||||| |||||||||||||| ||||||||||||||||| || || |||| ||| || || || ||||| |||||||| | |||||||||| | |
|
|
| T |
35407175 |
gtttcttaccataatcatacaaagattttgctctcaacacatcatgtactgtactcctccgcataggaaccgttccctttggacaccttgtcccatttcg |
35407076 |
T |
|
| Q |
250 |
gtgccacatttg |
261 |
Q |
| |
|
||||||||||| |
|
|
| T |
35407075 |
atgccacatttg |
35407064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University