View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17828_low_47 (Length: 238)
Name: NF17828_low_47
Description: NF17828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17828_low_47 |
 |  |
|
| [»] scaffold0076 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0076 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: scaffold0076
Description:
Target: scaffold0076; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 82 - 224
Target Start/End: Original strand, 46585 - 46727
Alignment:
| Q |
82 |
tgactttgatacggctgggacgttttttggtgtaagggtatatacgacgccaaaatgctattttccaccgatcaaatgatttatactccttatatttatc |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46585 |
tgactttgatacggctgggacgttttttggtgtaaaggtatatacgacgccaaaatgcgattttccaccgatcaaatgatttatactccttatatttatc |
46684 |
T |
 |
| Q |
182 |
ttgcacaaccaattttgaaaagtaattagttcttgttgtttct |
224 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46685 |
ttgcacaatcaattttgaaaagtaattagttcttgttgtttct |
46727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0076; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 46520 - 46574
Alignment:
| Q |
1 |
tgatgacgatcatccatctctgaccttagtatattctgatttctctcttctctct |
55 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46520 |
tgatgacgatcatccatctctgagcttagtatattctgatttctctcttctctct |
46574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 82 - 220
Target Start/End: Original strand, 12325004 - 12325142
Alignment:
| Q |
82 |
tgactttgatacggctgggacgttttttggtgtaagggtatatacgacgccaaaatgctattttccaccgatcaaatgatttatactccttatatttatc |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12325004 |
tgactttgatacggctgggacgttttttggtgtaaaggcatatacgacgccaaaatgcgattttccaccgatcaaatgatttatactccttatatttatc |
12325103 |
T |
 |
| Q |
182 |
ttgcacaaccaattttgaaaagtaattagttcttgttgt |
220 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12325104 |
ttgcacaatcaattttgaaaagtaattagttcttgttgt |
12325142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 12324934 - 12324988
Alignment:
| Q |
1 |
tgatgacgatcatccatctctgaccttagtatattctgatttctctcttctctct |
55 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12324934 |
tgatgacaatcatccatctctgaccttagtatattctgatttctctcttctctct |
12324988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 11202679 - 11202733
Alignment:
| Q |
1 |
tgatgacgatcatccatctctgaccttagtatattctgatttctctcttctctct |
55 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11202679 |
tgatgacaatcatccatctctgaccttagtatattctgatttctctcttctctct |
11202733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 161 - 224
Target Start/End: Original strand, 11202742 - 11202805
Alignment:
| Q |
161 |
tttatactccttatatttatcttgcacaaccaattttgaaaagtaattagttcttgttgtttct |
224 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||| |||||||||||| | ||||||||||| |
|
|
| T |
11202742 |
tttataatccttatatttatcttgcacaatcaattttaaaaagtaattaggttttgttgtttct |
11202805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University