View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17828_low_48 (Length: 238)
Name: NF17828_low_48
Description: NF17828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17828_low_48 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 36 - 238
Target Start/End: Complemental strand, 50421112 - 50420905
Alignment:
| Q |
36 |
ctcaagtctagtgattgattacgtgggtatcagagatctcaaaccgagtcaaaactt-----gacaacacaatgatgcttgaaactcacgcaccacattc |
130 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50421112 |
ctcaggtctagtgactgattacgtgggtatcaaagatctcaaaccgagtcaaaacttaataggacaacacaatgatgcttgaaactcacgcaccacattc |
50421013 |
T |
 |
| Q |
131 |
atactaaacacaagacggtgaaagaggaattacgtttgcgggggagctgtgtatccaagaccttgtcaaaatttaaaggcttaatagcaattttggcctc |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
50421012 |
atactaaacacaagacggtgaaagaggaattacgtttgcgggggagctgtgtaccgaagaccttgtcaaaatttaaaggcttaatagcagttttggcctc |
50420913 |
T |
 |
| Q |
231 |
ctgagtat |
238 |
Q |
| |
|
|| ||||| |
|
|
| T |
50420912 |
ctaagtat |
50420905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University