View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17828_low_53 (Length: 225)
Name: NF17828_low_53
Description: NF17828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17828_low_53 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 18 - 209
Target Start/End: Complemental strand, 3424530 - 3424339
Alignment:
| Q |
18 |
gcatgtatttttgctagaaatatttcaagatatatgatcttgttaagctactacaagcctatatggtcaagactttttatgcaaaaagacaaaaggtatc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3424530 |
gcatgtatttttgctagaaatatttcaagatatatgatcttgttaaggtactacaagcctatatggtcaagactttttatgcaaaaagacaaaaggtatc |
3424431 |
T |
 |
| Q |
118 |
caattatttgagataaatattaatatgattaaatgtgtannnnnnnnctaggttaatatgtttttatctctataaatatacgaacttttcat |
209 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3424430 |
caattatttgagataaattgtaatatgattaaatgtgtattttttttctaggttaatatgtttttatctctataaatatacgaacttttcat |
3424339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University