View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17828_low_55 (Length: 215)
Name: NF17828_low_55
Description: NF17828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17828_low_55 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 20 - 215
Target Start/End: Complemental strand, 48019041 - 48018846
Alignment:
| Q |
20 |
taatttccttgagtgtagcatgcgattgcgttcacaaaatcgggggaagaggtgtatggggcaaaagcaacaataaatgtgtgggatccaacggtggaag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48019041 |
taatttccttgagtgtagcatgcgattgcgttcacaaaatcgggggaagaggtgtatggggcaaaagcaacaataaatgtgtgggatccaacggtggaag |
48018942 |
T |
 |
| Q |
120 |
tagtcaacgaatttagtctttctcaaatttggattctttctggttcttttggtggctcagatcttaatagcattgaagctggttggcaggtatttt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48018941 |
tagtcaacgaatttagtctttctcaaatttggattctttctggatcttttggtggctcagatcttaatagcattgaagctggttggcaggtatttt |
48018846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 80 - 211
Target Start/End: Original strand, 35408297 - 35408428
Alignment:
| Q |
80 |
gcaaaagcaacaataaatgtgtgggatccaacggtggaagtagtcaacgaatttagtctttctcaaatttggattctttctggttcttttggtggctcag |
179 |
Q |
| |
|
||||||||| |||||| ||||||||||||| | | ||||| | ||||| || ||||| |||||||||||| | || ||||||||||| | ||| | | |
|
|
| T |
35408297 |
gcaaaagcatcaataagtgtgtgggatccatcaattgaagtgatgaacgagttcagtctctctcaaatttgggtcctctctggttctttcgatggtcctg |
35408396 |
T |
 |
| Q |
180 |
atcttaatagcattgaagctggttggcaggta |
211 |
Q |
| |
|
||||||| ||||| |||||||| ||||||||| |
|
|
| T |
35408397 |
atcttaacagcatcgaagctggatggcaggta |
35408428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University