View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17829_high_13 (Length: 303)
Name: NF17829_high_13
Description: NF17829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17829_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 21 - 280
Target Start/End: Original strand, 44553508 - 44553767
Alignment:
| Q |
21 |
gctcgtcctcagatttattagtgcttgaacttcaactttcggccaccttgacgaactcatccctcccatgaaagtctcgccattgttatcaactttcaca |
120 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44553508 |
gctcgtcctcagatttataagtgcttgaacttcaactttcggccaccttgacgaactcatccctcccatgaaagtctcgccattgttatcaactttcaca |
44553607 |
T |
|
| Q |
121 |
atttccatattcgtcaccaattgttgttgttgttgctgcgggactattgttgtgcctaacttgctaaccggaggtggttgtgctggcggcggcgttgtgt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44553608 |
atttccatattcgtcaccaattgttgttgttgttgctgctggactattgttgtgcctaacttgctaaccggaggtggttgtgctggcggcggcgttgtgt |
44553707 |
T |
|
| Q |
221 |
taacttgtaccactgatattggtactaccgccggtgttggtgttggtgctacacttcttt |
280 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44553708 |
taacttgtaccacagatattggtactaccgccggtgttggtgttggtgctacacttcttt |
44553767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University