View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17829_high_19 (Length: 224)
Name: NF17829_high_19
Description: NF17829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17829_high_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 5 - 210
Target Start/End: Original strand, 43729940 - 43730145
Alignment:
| Q |
5 |
gtaaagaaaaatgccttaattgtcttgacgggaggcttgttgattttcttcaaatgagctctgattctcttcaatttatgcaatgcaacatctggtctaa |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43729940 |
gtaaagaaaaatgccttaattgtcttgacgggaagcttgttgattttcttcaaatgagctctgattctcttcaatttatgcaatgcaacatctggtctaa |
43730039 |
T |
|
| Q |
105 |
aagtttggttagccttggagtgagattgtacttgtgatgaagttgaatttgagacaatggggtgtgacaaaattggactaattgaggtaaaaaacagaag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43730040 |
aagtttggttagccttggagtgagattgtacttgtgatgaagttgaatttgagacaatggggtgtgacaaaattggactaattgaggtaaaaaacagaag |
43730139 |
T |
|
| Q |
205 |
caaagt |
210 |
Q |
| |
|
|||||| |
|
|
| T |
43730140 |
caaagt |
43730145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University