View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17829_low_14 (Length: 335)
Name: NF17829_low_14
Description: NF17829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17829_low_14 |
 | |
|
| [»] scaffold0072 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0072 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: scaffold0072
Description:
Target: scaffold0072; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 315
Target Start/End: Complemental strand, 41964 - 41650
Alignment:
| Q |
1 |
gatagcaataccctgaatttgaccgtggaaccgcatggtgcctttacgagcagaaccgttcaaggcattcagtgacaagtggtgctcctccgtaacaata |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41964 |
gatagcaataccctgaatttgactgtggaaccgcatggtgcctttacgagcagaaccgttcaaggcattcagtgacaagtggtgctcctccgtaacaata |
41865 |
T |
|
| Q |
101 |
ggtggtgtttcagggtcagttgatggtgtgatttgcggtggtggtgggtcaggttcttcttcttcttcagtttgaaataagaaataatgacgatttggac |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41864 |
ggtggtgtttcagggtcagctgatggtgtgatttgttgtggtggtggttcaggttcttcttcttcttcagtttggaataagaaataatgacgatttggac |
41765 |
T |
|
| Q |
201 |
atttatgagatatagagaatcgttcatcacaataataacataatcttttttctcttctcagcatcatctcagatctagtgatgtttttaactgggtggcc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41764 |
atttatgagatatagagaatcgttcatcacaataatagcataatcctttttctcttctgagcatcatctcagctctagtgatgtttttaactgggtggcc |
41665 |
T |
|
| Q |
301 |
ttttgtgggtaggtt |
315 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41664 |
ttttgtgggtaggtt |
41650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University