View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17829_low_15 (Length: 333)
Name: NF17829_low_15
Description: NF17829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17829_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 278
Target Start/End: Complemental strand, 49585776 - 49585499
Alignment:
| Q |
1 |
cacgagggaaaatattctcacggcgtgttacacgcgctgtagtagcaactacattgaaaaagaatctctttagtggtagtggagtgcggcaacatgcaat |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49585776 |
cacgagggaaaatattctcacggtgtgttacacgcgctgtagtagcaactacattgaaaaagaatctctttagtggtagtggagtgcggcaacatgcaat |
49585677 |
T |
|
| Q |
101 |
acttgaagagaagggaacttaattaatccctgattaaggaaaatcacaaaccatggttttgttttattaaaactcgatattggtaaaaggatcgattaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
49585676 |
acttgaagagaagggaacttaattaatccctgattaaggaaaatcacaaaccatggttttgttttattaaaactcgttattggtaaaaagatcgattaat |
49585577 |
T |
|
| Q |
201 |
ttaagatgtctaattctaccgtctacttacacgggtctcattcaaagtctcagcaaaactttgtatatactaatctag |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
49585576 |
ttaagatgtctaattctaccgtctacttacatgggtcttattcaaagtcttagtaaaactttgtatatactaatctag |
49585499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University