View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1782_high_10 (Length: 287)
Name: NF1782_high_10
Description: NF1782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1782_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 74 - 277
Target Start/End: Complemental strand, 36679613 - 36679410
Alignment:
| Q |
74 |
tatagatgtgacttcagtcactttagttagtagttatttaacattggaagtcaaattttgggtttgtgaagattggtattttctagaatagatattcttg |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36679613 |
tatagatgtgacttcagtcactttagttagtagttatttaacattggaagtcaaattttgggtttgtgaagattgatattttctagaatagatattcttg |
36679514 |
T |
|
| Q |
174 |
tgcacactgtattgatgtacaatgtaatttagacatggatagatattcttgaattcaaatcattgtgatagtttaatgtgctatgtgcatcatattatcc |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36679513 |
tgcacactgtattgatgtacaatgtaatttagacatgaatagatattcttgaattcaaatcattgtgatagtttaatgtgctatgtgcatcatattatcc |
36679414 |
T |
|
| Q |
274 |
tatg |
277 |
Q |
| |
|
|||| |
|
|
| T |
36679413 |
tatg |
36679410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 18 - 77
Target Start/End: Complemental strand, 36679845 - 36679786
Alignment:
| Q |
18 |
agtactatcaattcttttttccatattcactcttattttcagttctagtcttaaaatata |
77 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36679845 |
agtactatcaattgttttttccatattcactcttattttcagttccagtcttaaaatata |
36679786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University