View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1782_high_8 (Length: 319)
Name: NF1782_high_8
Description: NF1782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1782_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 34488660 - 34488952
Alignment:
| Q |
18 |
aaaacccactttgatccaacacaaataacnnnnnnnatgagaggcatctttggaggatgaatatcgatcttgagggctgtcaagatgaaaaattctatca |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34488660 |
aaaacccactttgatccaacacacataacttttttgatgagaggcatctttggaggatgaatatcgatcttgagggctgtcaagatgaaaaattctatca |
34488759 |
T |
 |
| Q |
118 |
tatttactatagcagtcctcttagtcttgttccctgactgagacacacttgatatga---tgttaatagttgctttctagtgtatcatcttattctaaaa |
214 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34488760 |
tatttaccatagcagtcctcttagtcttgttccctgactgagacacacttgatatgatgatgttaatagttgctttctagtgtatcatcttattctaaaa |
34488859 |
T |
 |
| Q |
215 |
tcttgcttggtttctagaataccaaatagttaaatataatgatacaagctttgattgccaccttgcattaaggtgtccaatgcctataatttt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34488860 |
tcttgcttggtttctagaataccaaatagttaaaaataatgatacaagctttgattgccaccttgcattaaggtgtccaatgcctacaatttt |
34488952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University