View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1782_low_7 (Length: 343)
Name: NF1782_low_7
Description: NF1782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1782_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 9e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 9e-95
Query Start/End: Original strand, 19 - 225
Target Start/End: Complemental strand, 45590010 - 45589801
Alignment:
| Q |
19 |
gaacatgtgggagtggaactgagtttgagagtttggaaggttgttctgttcagataaccatgtaaatccatgtctctcgccagtactgtactagtgcctg |
118 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45590010 |
gaacatgtgggagttgaactgagtttgagagtttggaaggttgttctgttcagataaccatgtaaatccatgtctctcgccagtactgtactagtgccta |
45589911 |
T |
 |
| Q |
119 |
aacctccttccttcggttttatcctcaaaaattgataattttcggatatggccaaaaatgcatttgccatgtttaaatggggctcaaatat---tattta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| ||||||| |||||| |
|
|
| T |
45589910 |
aacctccttccttcggttttatcctcaaaaattgataattttcggatatggccaaaaatgcatttggcatttttaaatggggcacaaatattattattta |
45589811 |
T |
 |
| Q |
216 |
cttgatattt |
225 |
Q |
| |
|
|||||||||| |
|
|
| T |
45589810 |
cttgatattt |
45589801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 264 - 312
Target Start/End: Complemental strand, 45589797 - 45589749
Alignment:
| Q |
264 |
tgggatttgagtagaactattcatattttgtccatctccattgtttgat |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45589797 |
tgggatttgagtagaactattcatattttgtccatctccattgtttgat |
45589749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University