View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17830_high_2 (Length: 427)
Name: NF17830_high_2
Description: NF17830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17830_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 11 - 411
Target Start/End: Original strand, 53601616 - 53602035
Alignment:
| Q |
11 |
caaaggaatgaattcgtttctggtttgggctctgagctttgcgatcattatcgcgattgttcgcttcaacttcaaccttacgccatcatcattattatta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53601616 |
caaaggaatgaattcgtttctggtttgggctctgagctttgcgatcattatcgcgattgttcgcttcaacttcaaccttacgccatcatcattattatta |
53601715 |
T |
 |
| Q |
111 |
tttggatctcttctcatcgctttttggattatcaaaatgaaatttcatcatcggcgatttggaggaagttgtttgaacaaccccaaagtagaagataata |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53601716 |
tttggatctcttctcatcgctttttggattatcaaaatgaaatttcatcatcggcgatttggaggaagttgtttgaacaaccccaaagtagaagataata |
53601815 |
T |
 |
| Q |
211 |
gtgatgctaacaaccccattcctcctcaccttgtcatcatggttaatggcatcgttggcaggtaatcttcacctttactcataatcataacctataaaac |
310 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53601816 |
gtgatgctaacaaccctattcctcctcaccttgtcatcatggttaatggcatcgttggcaggtaatcttcacctttactcataatcataacctataaaac |
53601915 |
T |
 |
| Q |
311 |
acgacatt---------gacacagttaatagcatc----------atgtaatcaaatgtgtcggtactttcagttctcatgattggggatatggtgcaga |
391 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
53601916 |
acgacattgacaaatcagacacagttaatagcatcattgaactgaatgtaatcacatgtgtcggtactttcagttctcatgattggagatatggtgcaga |
53602015 |
T |
 |
| Q |
392 |
acagtttctcaagaggcttc |
411 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
53602016 |
gcagtttctcaagaggcttc |
53602035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University