View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17830_low_13 (Length: 239)
Name: NF17830_low_13
Description: NF17830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17830_low_13 |
 |  |
|
| [»] scaffold0239 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0239 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: scaffold0239
Description:
Target: scaffold0239; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 920 - 694
Alignment:
| Q |
1 |
aaccatgtggctgaaaagatttgttatggccaagcctggaaaaaatatacatgggaacatatagcct-tagttactgctaacaatttgacttttatttaa |
99 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |||||||| |
|
|
| T |
920 |
aaccatgtggctgaaaagacttgttatggccaagcctggaaaaaatatacatgggaacatatagcctatagttaccgctaacaatttgactcttatttaa |
821 |
T |
 |
| Q |
100 |
gaactaaaactaccaacatcttagtaatagtataacaatgttgcttattattccttgtccattgtagaagaaatatgtgatc-----acataatgataaa |
194 |
Q |
| |
|
||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
820 |
gaatcatacctaccaacatcttagtaatagtataacaatgttgcttattattccttgtccatggtagaagaaatatgtgatcacatcacataatgataaa |
721 |
T |
 |
| Q |
195 |
aacatattgcagttatgcgtctatatt |
221 |
Q |
| |
|
|||| |||||||||||||||||||||| |
|
|
| T |
720 |
aacaaattgcagttatgcgtctatatt |
694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University