View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17830_low_6 (Length: 321)
Name: NF17830_low_6
Description: NF17830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17830_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 13 - 202
Target Start/End: Original strand, 20861631 - 20861823
Alignment:
| Q |
13 |
agcagagatgaagaggaatccggtgaatgtgattctgaatttgtggaggcaactcagaatcagaatgagacaaattcaaatgatggga---ttcaagtgc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
20861631 |
agcagagatgaagaggaatccggtgaatgtgattctgaatttgtggaggcaactcagaatcagaatgagacaaattcaaatgatgggattcttcaagtgc |
20861730 |
T |
|
| Q |
110 |
atagcaaaagtccagaacagcaggtgcctacttttgaaagagtaaagaaagatatggaattcttaacaaaatcctgggcaaaaattgccgaga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
20861731 |
atagcaaaagtccagaacagcaggtgcctactcttgaaagagtaaagaaagatatggaattcttaacaaaatcctaagcaaaaattgccgaga |
20861823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 200 - 298
Target Start/End: Original strand, 20861858 - 20861956
Alignment:
| Q |
200 |
agagaaatgatcaacatgtagatgctgaaggctttcaagttcaattctcaaagagtcatatgaagaaggcgcaaaagaaattgaaacaaataagcaaga |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20861858 |
agagaaatgatcaacatgtagatgctgaaggctttcaagttcaattctcaaagagtcatacgaagaaggcgcaaaagaaattgaaacaaataagcaaga |
20861956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University