View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17830_low_7 (Length: 319)
Name: NF17830_low_7
Description: NF17830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17830_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 5e-96; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 9 - 210
Target Start/End: Original strand, 2490483 - 2490684
Alignment:
| Q |
9 |
gactaaacattatactaagacctaatccgaaatggttatgagttggtcttgaatttggaatcttaagctcccttaaaaatattcatcattttacatggaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
2490483 |
gactaaacattatactaagacctaatccgaaatggttatgagttggtcttgaatttggaatcttaagctccctaacaaatattcatcattttacatggaa |
2490582 |
T |
|
| Q |
109 |
ttttatgcatgggaagttgcctactaaccatgtttagtacactcatgatatttctttatatgcttattgttattgatgttgtgcttcgtcaaaaactatt |
208 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
2490583 |
ttttatgcatgggaagttgtctaataaccatgtttagtacactcatgatatttctttatatgcttattgttattgatgtggtgcttcgtcaaaaactttt |
2490682 |
T |
|
| Q |
209 |
tt |
210 |
Q |
| |
|
|| |
|
|
| T |
2490683 |
tt |
2490684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 194 - 279
Target Start/End: Original strand, 2491698 - 2491783
Alignment:
| Q |
194 |
tcgtcaaaaactattttacaactattgcggatttgatggtagtttgattggtaacctcgatatatcaggatttggaggtttgatca |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |||| |
|
|
| T |
2491698 |
tcgtcaaaaactattttacaactattgcggatttgatggtagtttgattgataacctcgatatatcaagatttggaggttttatca |
2491783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 272 - 311
Target Start/End: Original strand, 2491948 - 2491987
Alignment:
| Q |
272 |
tttgatcaaggacatggtcgtgcctactcgtccctatgct |
311 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
2491948 |
tttgataaaggacatggtcgtgcctactcgtccttatgct |
2491987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University