View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17831_high_25 (Length: 205)
Name: NF17831_high_25
Description: NF17831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17831_high_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 52 - 190
Target Start/End: Original strand, 1591030 - 1591169
Alignment:
| Q |
52 |
tttcttctggttttggatgaggaattatgagagggtatgaaggggtatatatatgtgtcaaaagtggatacgaggctaaaataaaacaagaggaaaatac |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1591030 |
tttcttctggttttggatgaggaattatgagagggtatgaaggggtatatatatgtgtcaaaagtggatacgaggctaaaataaaacaagaggaaaatac |
1591129 |
T |
|
| Q |
152 |
tctttg-tttgaagtggaagaattgaaagtgatgtatatg |
190 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1591130 |
tctttgttttgaagtggaagaattgaaagtgatgtatatg |
1591169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University