View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17831_low_13 (Length: 306)
Name: NF17831_low_13
Description: NF17831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17831_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 19 - 168
Target Start/End: Original strand, 32560406 - 32560557
Alignment:
| Q |
19 |
atcttccctgcaactgt--aagcaaggatttcttactgaaaaccttccaaggcttctttccttattttcaacgcacttacataaagggtaacaagggaag |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32560406 |
atcttccctgcaactgtgtaagcaaggatttctgactgaaaaccttcgaaggcttctttccttattttcaacacacttacataaagggtaacaagggaag |
32560505 |
T |
|
| Q |
117 |
atgattttggtaaagaaaatatgaaatcgagaatcaattgagccaaacgcag |
168 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32560506 |
atgagtttggtaaagaaaatatgaaatcgagaatcaattgagccaaacgcag |
32560557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 196 - 295
Target Start/End: Original strand, 32560571 - 32560670
Alignment:
| Q |
196 |
gatgactacttcagctccttcaaagaattacgcagatgacgtcagcctcctcgtcgtcacactcgacaccaaccctttcttctggtcttctttccccttt |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32560571 |
gatgactacttcagctccttcaaagaattacgcagatgacgtcagcctcctcgtcgtcacactcgacaccaaccctttcttctggtcttctttccccttt |
32560670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University