View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17831_low_17 (Length: 254)
Name: NF17831_low_17
Description: NF17831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17831_low_17 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 12 - 254
Target Start/End: Complemental strand, 46679038 - 46678796
Alignment:
| Q |
12 |
tagcaaaggcggctttgtctatagctagtttccacacaggtaattacagtcaccttacaaccttcacttttgctttctcacacttttcccacggaaattt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46679038 |
tagcaaaggcggctttgtctatagctagttcccacacaggtaattacagtcaccttacaaccttcacttttgctttctcacacttttcccacggaaattt |
46678939 |
T |
 |
| Q |
112 |
tactttgagcttgtaannnnnnnncattcggccataacaattgtttctatattctgttgggtgaaatctatgtcattatctttataaaatagttatatgt |
211 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46678938 |
tactttgagcttgtaatttttttttattcggccataacaattgtttctatattctgttgggtgaaatctatgtcgttatctttataaaatagttatatgt |
46678839 |
T |
 |
| Q |
212 |
tattnnnnnnnnttgatttggccataacacttgaatagaactc |
254 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46678838 |
tattaaaaagaattgatttggccataacacttgaatagaactc |
46678796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University