View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17831_low_19 (Length: 237)
Name: NF17831_low_19
Description: NF17831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17831_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 38847614 - 38847393
Alignment:
| Q |
1 |
tccgattacaatttaacctaacaatcaaattcgaactctggnnnnnnnnnnnnacaatgtgttttt-gtatatgcagacctatatgttcaagtatgacac |
99 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38847614 |
tccgattacaatttaacctaacaatcaaagtcgaactctggatttttatttttacaatgtgttttttgtatatgcagacctatatgttcaagtatgacac |
38847515 |
T |
 |
| Q |
100 |
tgttcacggtcagtggaagcattttgaacttaaggttaaggacactaagacccttctctttggtgagaaagaagttgctgttttcggaaccaggtaattt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38847514 |
tgttcacggtcagtggaagcattttgaacttaaggttaaggacactaagacccttctctttggtgagaaagaagttgctgttttcggaaccaggtaattt |
38847415 |
T |
 |
| Q |
200 |
attatctctgattgtggatctg |
221 |
Q |
| |
|
|| |||||||||| |||||||| |
|
|
| T |
38847414 |
atgatctctgattttggatctg |
38847393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University