View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17831_low_25 (Length: 211)
Name: NF17831_low_25
Description: NF17831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17831_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 52 - 152
Target Start/End: Complemental strand, 30872392 - 30872291
Alignment:
| Q |
52 |
taattcattcaatgaaaagagaagattgta-attgtattgagtattccctgactttcatacagcatccggaatatgcttatagtacacatgaatatgctt |
150 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30872392 |
taattcattcaatgaaaagagaagattgtgcattgtactgagtattccctgactttcatacggcatccggaatatgcttatggtacacatgaatatgctt |
30872293 |
T |
 |
| Q |
151 |
gt |
152 |
Q |
| |
|
|| |
|
|
| T |
30872292 |
gt |
30872291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 3163434 - 3163462
Alignment:
| Q |
1 |
atacaatttgggacggagggagtacctaa |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3163434 |
atacaatttgggacggagggagtacctaa |
3163462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University