View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17831_low_25 (Length: 211)

Name: NF17831_low_25
Description: NF17831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17831_low_25
NF17831_low_25
[»] chr6 (1 HSPs)
chr6 (52-152)||(30872291-30872392)
[»] chr1 (1 HSPs)
chr1 (1-29)||(3163434-3163462)


Alignment Details
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 52 - 152
Target Start/End: Complemental strand, 30872392 - 30872291
Alignment:
52 taattcattcaatgaaaagagaagattgta-attgtattgagtattccctgactttcatacagcatccggaatatgcttatagtacacatgaatatgctt 150  Q
    |||||||||||||||||||||||||||||  |||||| ||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||    
30872392 taattcattcaatgaaaagagaagattgtgcattgtactgagtattccctgactttcatacggcatccggaatatgcttatggtacacatgaatatgctt 30872293  T
151 gt 152  Q
    ||    
30872292 gt 30872291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 3163434 - 3163462
Alignment:
1 atacaatttgggacggagggagtacctaa 29  Q
    |||||||||||||||||||||||||||||    
3163434 atacaatttgggacggagggagtacctaa 3163462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University