View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17831_low_26 (Length: 211)

Name: NF17831_low_26
Description: NF17831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17831_low_26
NF17831_low_26
[»] chr7 (1 HSPs)
chr7 (16-193)||(2423237-2423414)


Alignment Details
Target: chr7 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 16 - 193
Target Start/End: Complemental strand, 2423414 - 2423237
Alignment:
16 agagattgagagaggtattaaggagtggaagttgcatattgaagaagttcaaaaagcatgaagatgaaacagatccagttctttactttttctctcaagt 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2423414 agagattgagagaggtattaaggagtggaagttgcatattgaagaagttcaaaaagcatgaagatgaaacagatccagttctttactttttctctcaagt 2423315  T
116 ggatttgaaacttgtttgtagagtgttgaatatgtcaaggataacaactgatcaactagcatggtgtcgtagtaaact 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2423314 ggatttgaaacttgtttgtagagtgttgaatatgtcaaggataacaactgatcaactagcatggtgtcgtagtaaact 2423237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University