View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17831_low_7 (Length: 414)
Name: NF17831_low_7
Description: NF17831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17831_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 3e-89; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 211 - 385
Target Start/End: Original strand, 1852940 - 1853114
Alignment:
| Q |
211 |
aggagcatgctaatctaaaatttgtgtgcaaataataacattacaggaatagctgctcttgttgctgctggattttttggttatatgttagcattactta |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1852940 |
aggagcatgctaatctaaaatttgtgtgcaaataataacattacaggaatagctgctcttgtttctgctggattttttggttatatgttagcattactta |
1853039 |
T |
|
| Q |
311 |
agaggagggtgacagatatgttttcatcttcagatgtaagttattatcttctatacaatgacccctcagggtgac |
385 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1853040 |
agaggagggtgacggatatgttttcatcttcagatgtaagttattatcttctatacaatgacccctcagggtgac |
1853114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 19 - 147
Target Start/End: Original strand, 1852748 - 1852876
Alignment:
| Q |
19 |
ctcttttggtggttgatagaggaaatcaagcaattagagagatacaactcaatcaagatgattgcattactagtactactactactaatgatgaatatga |
118 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1852748 |
ctcttttggtggatgatagaggaaatcaagcaattagagagatacaactcaatcaagatgattgcattactagtactactactactaatgatgaatatga |
1852847 |
T |
|
| Q |
119 |
gtatgacaatagtttccccttaggtatga |
147 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1852848 |
gtatgacaatagtttccccttaggtatga |
1852876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University