View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17832_high_3 (Length: 255)
Name: NF17832_high_3
Description: NF17832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17832_high_3 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 28415842 - 28416039
Alignment:
| Q |
19 |
ggtaggaacattttgttatgcaagagtcaaagttgaaactatggattcctcacttcataaccttacatgatgaatttatagctaccgagactatttgaca |
118 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28415842 |
ggtaggaacattgtgttgtgcaagagtcaaagttgaaactatggattcctcacttcataaccttacatgatgaatttatagccaccgagactatttgaca |
28415941 |
T |
|
| Q |
119 |
aaaacatagtactaagacattttctatatataaactagtacnnnnnnnnnnnngacaagtagcctagactttgttttggagtttttgaggggaatggaag |
218 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||| | ||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28415942 |
aaaacatagtattaaggcattttctatatataaactagtac---tttttttatgtcaagtagcccagactttgtttcggagtttttgaggggaatggaag |
28416038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 205 - 255
Target Start/End: Original strand, 1839658 - 1839708
Alignment:
| Q |
205 |
gaggggaatggaaggaaaggttttgggaggacaaaaatatagagaaaaatt |
255 |
Q |
| |
|
|||||||| ||||||||||| |||||| |||||||| ||||||| |||||| |
|
|
| T |
1839658 |
gaggggaagggaaggaaaggctttggggggacaaaattatagaggaaaatt |
1839708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 255
Target Start/End: Complemental strand, 53888746 - 53888679
Alignment:
| Q |
187 |
ctttgttttggagtttttgaggggaatggaaggaaaggttttgggaggacaaaaatatagagaaaaatt |
255 |
Q |
| |
|
|||||||| ||||||| ||||||| ||||||||||| |||||| |||||||||||||| | |||||| |
|
|
| T |
53888746 |
ctttgtttgggagtttg-gaggggaggggaaggaaaggctttgggtggacaaaaatataggggaaaatt |
53888679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University