View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17833_high_100 (Length: 255)
Name: NF17833_high_100
Description: NF17833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17833_high_100 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 29606879 - 29606635
Alignment:
| Q |
1 |
ctttttgtgtgtaggtgctggtgctggtgcttctttggccggtgctggtgcttttggaacctttgcaggtgctggggatacctttggtggtttagaagct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29606879 |
ctttttgtgtgtaggtgctggtgctggtgcttctttggccggtgctggtgcttttggaacctttgcaggtgctggggatacctttggtggtttagaagct |
29606780 |
T |
 |
| Q |
101 |
ggtggtaatggtaatggtggaagtgaaacaggtggtatagataatggtggtagagaaacaggtgcttttttgggtggatgtggtggtggttgaattttag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29606779 |
ggtggtaatggtaatggtggaagtgaaacaggtggtatagataatggtggtagagaaacaggtgcttttttgggtggatgtggtggtggttgaattttag |
29606680 |
T |
 |
| Q |
201 |
gggatggggtttttgggcttaatgccggtgtaacctttggtactg |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29606679 |
gggatggggtttttgggcttaatgccggtgtaacctttgggactg |
29606635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 29606939 - 29606888
Alignment:
| Q |
1 |
ctttttgtgtgtaggtgctggtgctggtgcttctttggccggtgctggtgct |
52 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||| | ||||| |||||| |
|
|
| T |
29606939 |
ctttttgtgtgtaggtgctggtgccggtgtttctttgtctggtgcgggtgct |
29606888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University